San Diego University Umbrella Corporation Nucleotide Sequence Information Worksheet

Homework #2:

Premise: There has been a shipwreck. The cause of the shipwreck is unknown because nobody survived the incident. Upon investigation, samples of a powdery substance as well as blood samples were discovered in a mysterious box aboard the ship.

Each lab member will be assigned a sample set which includes the sequencing results from the powdery substance (“sequence 1”) and the blood sample (“sequence 2”). You are responsible for analyzing your assigned nucleotide sequences.

Each student will independently fill out a “Confidential Researcher Report Form” from the company that hired them in investigate the accident. They will describe in detail their findings about their assigned sequences and, ultimately, have to draw a conclusion about how all the passengers died using the analysis of the blood sample and what they found in their independent research.

• Please make sure you are working on your assigned sample set:
  • Find which sample set you’re assigned to on Canvas under the “People” section then click on the “Groups” tab.
• Open NCBI BLAST website: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch
• Copy the first sequence from your sample set and paste it into the BLAST query field.
• Click “BLAST”
• Refer to the “Confidential Researcher Report Form” to know what key features to investigate.
• Explore the features of BLAST to find as much information as you can.
• Repeat for the second sequence in your sample set.

Sequences

Sample Set 1Sequence 1: ggcgcacagctgctcgcgcgccgcctccagggccgccggcgacttccaggcgcccccgcgcactcgcccgaagcgcacccacacctcgtcccactcggccgcggcggcctccagcgagcgccgcagggcggtcgtccggcggcacgcctcgccgagcgcgtccaggcgcccgtgcagccgcgcgagggggtcgggggcgccgtcgcgcgcggcggtcagcgatggagttcccctttgggtccgtgggaactaccaacttcagacggttcactccagagtcgctggcagagatcgagaagcagatcgctgcccaccgcgccgccaagaagggcagacctaagcaaagaggacagaaggacaagagtgagaagcccaggcctcagttggacttgaaggcctgtaaccagctgcccaggttctatggcgagctcccagcagagctggtcggggagcccctggaggacctggatcctttctacagcacacaccggacattcatagtgttggataaaagcaggaccatttccagattcagtgccacttgggctctgtggctcttcagtcccSequence 2: acattctccttcttatagactcaggaagcaatcatggtgctctctgcagatgacaaaaccaacatcaagaactgctgggggaagattggtggccatggtggtgaatatggcgaggaggccctacagaggtgagatcaggaccctgttctttaaggacagcaggatccaaaccggaccagggactcagtgggcagctcctaagtgtgctttcccgtggcctcaacttatctctccttctcacaggatgtt

using these information you need to fill out this paper that I uploaded.