Cuyamaca College Nucleotide Sequence Information Lab Report
Question Description
Premise: There has been a shipwreck. The cause of the shipwreck is unknown because nobody survived the incident. Upon investigation, samples of a powdery substance as well as blood samples were discovered in a mysterious box aboard the ship.Each lab member will be assigned a sample set which includes the sequencing results from the powdery substance (sequence 1) and the blood sample (sequence 2). You are responsible for analyzing your assigned nucleotide sequences. Each student will independently fill out a Confidential Researcher Report Form from the company that hired them in investigate the accident. They will describe in detail their findings about their assigned sequences and, ultimately, have to draw a conclusion about how all the passengers died using the analysis of the blood sample and what they found in their independent research.
Sample Set 7
Sequence 1:
gtatcgagaggactttcagatggatgaaggagaggatcctagcctcctgttccagtcatacctggacaatgttggagtccaaatagtcagacaaataaggtcaggagagagatttctcaagatatggtcacagaccgtagaagagattatatcctatgtcgcggtcaactttcccaaccctccaggaaagtcttcagaggataaatcaacccagactaccggccgagagctcaagaaggagacaacacccactccttctcagagagaaagccaatcctcgaaagccaggatggcggctcaaactgcttctggccctccagcccttgaatggtcggccaccaatgaagaggatgatctatcagtggaggctgagatcgctcaccagattgcggttcgccagtctcatggtaagtctctagactacatcgggtacatttccccatactctggggttaccggctacaaccagaagtttaaaggtaaggcgacccttactgtcgacaaatcttcctcaactgcttacatggagctgcgttctttgacctctgaggactccgcggtatactattgcgcgggctcctctggtaacaaatgggccatggattattggggtcat
Sequence 2:
tggacaaccttaagggtgcctttgctaagctgagtgagctgcactgtgacaaactgcatgtggatcctgagaacttcaaagtgagtttaggagatgctcatgagctctttctggttttataacttagcacaataatgggatataagactatgattggagagatcaacaaagatttcagaagtcatagatatgttttgttgttagagatctccaatggtcatcaacaagaccaatttaattcagaaatagtaaggtaaaaggctattaacagtctaatttttcagaaaatgatgtgtttatcctgagaataatgt
- Open NCBI BLAST website: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch
- Copy the first sequence from your sample set and paste it into the BLAST query field.
- Click BLAST
- Refer to the “Confidential Researcher Report Form” to know what key features to investigate.
- Explore the features of BLAST to find as much information as you can.
- Repeat for the second sequence in your sample set.
"Place your order now for a similar assignment and have exceptional work written by our team of experts, guaranteeing you "A" results."